Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: miR-21 expression is upregulated in denervated mouse gastrocnemius muscles a) Heat map of 18 different miRNAs in denervated mouse gastrocnemius muscles and normal gastrocnemius muscles (n = 6). b) qRT-PCR analysis of the expression of microRNA expression in denervated gastrocnemius muscle relative to normal tissue,n = 6,*P < 0.05. c) In situ hybridization of miR-21 expression levels in denervated mouse gastrocnemius muscles and normal gastrocnemius muscles, scale bar = 20um. d) qRT-PCR analysis of the expression of TGF-β1, α-SMA and CTGF ingastrocnemius muscle tissue 2 weeks after denervation, n = 6, *P < 0.05. e) Western blot and quantitative analysis (right) of TGF-β1, α-SMA and CTGF in gastrocnemius muscle tissue 2 weeks after denervation, n = 6, *P < 0.05.

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, Muscles, Quantitative RT-PCR, In Situ Hybridization, Western Blot

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: TGF-β1 up-regulated expression of miR-21 in C2C12 cells, which correlates with α-SMA and CTGF expression a) qRT-PCR analysis of the expression of miR-21 in C2C12 cells 0,12h,24h,48h after treatment of TGF-β1; n = 6, *P < 0.05. b) qRT-PCR analysis of the expression of CTGF, α-SMA and miR-21 in C2C12 cells 24 h after treatment of TGF-β1compared with control; n = 6, *P < 0.05. c) Western blot and quantitative analysis of CTGF and α-SMA in C2C12 cells 24 h after treatment of TGF-β1; n = 6, *P < 0.05. d) qRT-PCR analysis of the expression of miR-21 in NIH3T3 cells 0,12h,24h,48h after treatment of TGF-β1; n = 6, *P < 0.05. b) qRT-PCR analysis of the expression of CTGF, α-SMA and miR-21 in NIH3T3cells 24 h after treatment of TGF-β1compared with control; n = 6, *P < 0.05. c) Western blot and quantitative analysis of CTGF and α-SMA in NIH3T3 cells 24 h after treatment of TGF-β1.

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, Quantitative RT-PCR, Control, Western Blot

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: The effects of miR-21 on fibrosis-related protein expression in vitro a) mRNA expression of α-SMA and CTGF in C2C12 cells transfected with anti-miR-21, NC, or miR-21 mimics; *P < 0.05. b) Western blots showing the expression of α-SMA and CTGF in C2C12 cells transfected with anti-miR-21, NC, or miR-21 mimics. Bar graphs showing the quantified Western blotting results normalized to GAPDH; *P < 0.05. c) Immunofluorescence staining of α-SMA and CTGF protein in C2C12 cells transfected with anti-miR-21, NC, or miR-21 mimics. d) mRNA expression of α-SMA and CTGF in NIH3T3 cells transfected with anti-miR-21, NC, or miR-21 mimics; *P < 0.05. e) Western blots showing the expression of α-SMA and CTGF in NIH3T3 cells transfected with anti-miR-21, NC, or miR-21 mimics. Bar graphs showing the quantified Western blotting results normalized to GAPDH; *P < 0.05. f) Immunofluorescence staining of α-SMA and CTGF protein in NIH3T3 cells transfected with anti-miR-21, NC, or miR-21 mimics, scale bar = 50um.

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, In Vitro, Transfection, Western Blot, Immunofluorescence, Staining

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: The effects of miR-21 on fibrosis-related protein expression in vivo a) qRT-PCR analysis of the expression of miR-21 in gastrocnemius muscles of denervated mice（n = 6,#P < 0.05,compared with control; *P < 0.05 compared with pLKO- NC group); b) qRT-PCR analysis of the expression of CTGF and α-SMA in gastrocnemius muscles of denervated mice（n = 6,#P < 0.05,compared with control; *P < 0.05 compared with pLKO- NC group); c）Western blots showing CTGF, and α-SMA protein expression in gastrocnemius muscles of denervated mice. d)Bar graphs depicting the quantified Western blotting bands shown in c) by densitometry and normalized to GAPDH expression; （n = 6,#P < 0.05,compared with control; *P < 0.05 compared with pLKO- NC group); e) Masson's trichrome staining of gastrocnemius muscles harvested 2 and 4-weeks post-denervation, scale bar = 20um. f) Quantification of gastrocnemius muscle fibrosis in the indicated groups of mice （n = 6,#P < 0.05,compared with control; *P < 0.05 compared with pLKO- NC group). g) Immunofluorescence staining of CTGF, and α-SMA in gastrocnemius muscles of denervated mice, scale bar = 50um (2 weeks after denervation).

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, In Vivo, Quantitative RT-PCR, Muscles, Control, Western Blot, Staining, Immunofluorescence

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: SMAD7 is a direct target of miR-21 a) Western blots showing the expression of SMAD7 protein in the muscles of denervated mice (2 weeks after denervation). b) Bar graphs represent quantifications of the Western blotting bands by densitometry relative to β-actin expression; n = 6, *P < 0.05. c) Luciferase reporter assays in HEK293T cells co-transfected with miR-21 and either WT smad7 3′-UTR or Mut smad7 3′-UTR. d) mRNA expression of Smad7 in C2C12 cells transfected with miR-21 mimics or NC; n = 6, *P < 0.05. e) Western blots showing the expression of Smad7 protein in C2C12 cells transfected with miR-21 mimics or NC. f) Bar graphs represent quantifications of the Western blotting bands by densitometry relative to β-actin expression; n = 6, *P < 0.05.

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Western Blot, Expressing, Muscles, Luciferase, Transfection

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: miR-21 promotes fibrosis by suppressing the SMAD7 signaling pathway in C2C12 cells a) mRNA expression of CTGF and α-SMA in C2C12 cells transfected with anti-miR-21 with or without SMAD7 siRNA; n = 6, *P < 0.05. b) Western blots showing CTGF and α-SMA expression in C2C12 cells transfected with anti-miR-21 with or without SMAD7 siRNA. c）Bar graphs represent quantifications of the Western blotting bands relative to GAPDH expression; *n = 6, P < 0.05. d）Western blots showing the expression of p -SMAD2/3, SMAD2/3, and SMAD7 in the cytoplasm in C2C12 cells transfected with anti-miR-21 with or without SMAD7 siRNA. e) Bar graphs represent quantifications of the Western blotting bands relative to GAPDH expression; n = 6, *P < 0.05. f) Western blots showing the expression of SMAD2/3 in the nuclear in C2C12 cells transfected with anti-miR-21 with or without SMAD7 siRNA. g) Bar graphs represent quantifications of the Western blotting bands relative to LamniB1 expression; n = 6, *P < 0.05. h) Distributional changes SMAD2/3 were assessed by imunostaining bar = 50 μm). i) Bar graphs represent nuclear translocation of smad2//3. j)Western blots showing smad2/3 psmad2/3 and smad7 protein expression in gastrocnemius muscles of denervated mice.

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, Transfection, Western Blot, Translocation Assay, Muscles

Journal: Heliyon

Article Title: MiR-21 regulates skeletal muscle atrophy and fibrosis by targeting TGF-beta/SMAD7-SMAD2/3 signaling pathway

doi: 10.1016/j.heliyon.2024.e33062

Figure Lengend Snippet: miR-21 promotes fibrosis by suppressing the SMAD7 signaling pathway in NIH3T3 cells a) mRNA expression of CTGF and α-SMA in NIH3T3cells transfected with anti-miR-21 with or without SMAD7 siRNA; n = 6, *P < 0.05. b) Western blots showing CTGF and α-SMA expression in NIH3T3cells transfected with anti-miR-21 with or without SMAD7 siRNA. c）Bar graphs represent quantifications of the Western blotting bands relative to GAPDH expression; *n = 6, P < 0.05. d）Western blots showing the expression of p -SMAD2/3, SMAD2/3, and SMAD7 in the cytoplasm in NIH3T3 cells transfected with anti-miR-21 with or without SMAD7 siRNA. e) Bar graphs represent quantifications of the Western blotting bands relative to GAPDH expression; n = 6, *P < 0.05. f). Bar graphs represent nuclear translocation of smad2//3. g) Distributional changes SMAD2/3 were assessed by imunostaining bar = 50 μm).

Article Snippet: Then they were acetylated by incubation in acetic anhydride/triethanolamine and pre-hybridized in a hybridization solution (50 % formamide, 0.3 M sodium-chloridep (H 7.0), 20 mM Tris-HCl, 5 mM ethylenediaminetetraacetic acid, 1 × Denhardt's solution, and 0.5 mg/mL yeast tRNA) for 4 h. The samples were incubated in pre-hybridization buffer for 1 h at 37 °C, then hybridized with 8 ng/μL digoxigenin-labeled miR-21 oligonucleotide probes (5‘TCAACATCAGTCTGATAAGCTA3’) (Sangon Biotech, Shanghai, China) overnight at 37 °C.

Techniques: Expressing, Transfection, Western Blot, Translocation Assay